Differentiate between RNA polymerase and DNA polymerase?
Asked by shitikanthdas31 | 14th Aug, 2019, 12:16: AM
Expert Answer:
Differences between RNA polymerase and DNA polymerase:
|
DNA polymerase |
RNA polymerase |
|
|
|
|
|
|
|
|
|
|
Answered by Sheetal Kolte | 14th Aug, 2019, 11:34: AM
Related Videos
- What is steam used for the genes that transcribe in dna coding for more than one type of polypetide chain.answer in one word.
- Mention the 3 different types of Rna,along alon their individual functions.
- What is anti codon
- Explain the process of making heterogeneous nuclear RNA (hnRNA) into a fully functional mRNA in eukaryotes. Where does this process occur in the cell?
- describe transcription briefly.(long question)
- if a dna segment consists of 90 nucleotides pairs then a) what will be the no. of amino acids in the polypeptide chain which are translated from it? b) what will be the no. of nucleotides in mRNA transcribed from it? c) how many nitrogenous bases r present in the dna segment?
- Write the 2 specific codons that a translational unit of mRNA is flanked by one on either sides.
- The sequence of one strand of DNA is written as follows: 5'- ATGCATGCATGCATGCATGCATGCATGC - 3'. Write down the sequence of the complementary strand in 5' ~ 3' direction.
- If the sequence of the coding strand in a transcription unit is written as follows: 5'·ATGCATGCATGCATGCATGCATGCATGC·3'. Write down the sequence of mRNA.
Kindly Sign up for a personalised experience
- Ask Study Doubts
- Sample Papers
- Past Year Papers
- Textbook Solutions
Sign Up
Verify mobile number
Enter the OTP sent to your number
Change