Please wait...
1800-212-7858 (Toll Free)
9:00am - 8:00pm IST all days


Thanks, You will receive a call shortly.
Customer Support

You are very important to us

For any content/service related issues please contact on this toll free number


Mon to Sat - 11 AM to 8 PM

Ask Transcription Genetic Code And Types Of Rna question free ×
  • CBSE×
  • Class 12 Science×
  • Biology×
  • Molecular Basis Of Inheritance×
  • Transcription Genetic Code And Types Of Rna×

Transcription Genetic Code And Types Of Rna Free Doubts and Solutions

CBSE - XII Science - Biology - Molecular Basis of Inheritance

Write the 2 specific codons that a translational unit of mRNA is flanked by one on either sides. 

Asked by pksunilnair 24th March 2018, 5:07 PM
Answered by Expert

Answer this question

Your answer has been posted successfully!

CBSE - XII Science - Biology - Molecular Basis of Inheritance

 how many amino acids will be coded by mRNA sequence- 5`CCCUCAUAGUCAUAC3` if adenosine residue is inserted after 12th nucleotide?

Asked by Mandal 4th January 2017, 10:41 PM
Answered by Expert

Answer this question

Your answer has been posted successfully!

CBSE - XII Science - Biology - Molecular Basis of Inheritance

where exactly is gene present on dna or on chromosome plz explain alongwith diagram and plzz explain in detail what is actually chromosomal theory of inheritance

Asked by upmaniousagarika 8th June 2016, 11:02 PM
Answered by Expert

Answer this question

Your answer has been posted successfully!

CBSE - XII Science - Biology - Molecular Basis of Inheritance

Which sequence of RNA is transcribed from a hypothetical sequence of DNA given below?
Explain in detail.

Asked by Kb Aulakh 20th April 2015, 5:17 PM
Answered by Expert

Answer this question

Your answer has been posted successfully!

CBSE - XII Science - Biology - Molecular Basis of Inheritance

1.Whats DNA?where is it present?
2.can u explain DNA transcription process?

Asked by divyashrisureshbabu 11th October 2014, 2:17 PM
Answered by Expert

Answer this question

Your answer has been posted successfully!

CBSE - XII Science - Biology - Molecular Basis of Inheritance

1. what are clonning vector ? write the feature that are required to facilitate cloning in a vector.
2. write the basic three steps in genetically modifying an organism.

Asked by poojaparmar065 1st October 2014, 2:51 PM
Answered by Expert

Answer this question

Your answer has been posted successfully!

CBSE - XII Science - Biology - Molecular Basis of Inheritance

Why is tRNA called an adapter molecule? What is the meaning of adapter here?

Asked by 26th June 2014, 3:58 PM
Answered by Expert

Answer this question

Your answer has been posted successfully!

CBSE - XII Science - Biology - Molecular Basis of Inheritance

(a) Explain the functions of (i) Promoter (ii) tRNA and (iii) Exons. (b) Differentiate between mRNA and tRNA. 

Asked by Topperlearning User 16th June 2014, 5:12 PM
Answered by Expert

Answer this question

Your answer has been posted successfully!

CBSE - XII Science - Biology - Molecular Basis of Inheritance

What are three major classes of RNA? Mention their functions.

Asked by Topperlearning User 16th June 2014, 5:12 PM
Answered by Expert

Answer this question

Your answer has been posted successfully!

CBSE - XII Science - Biology - Molecular Basis of Inheritance

Explain (a) Cistron, (b) Operator gene and (c) Promoter gene.

Asked by Topperlearning User 16th June 2014, 5:12 PM
Answered by Expert

Answer this question

Your answer has been posted successfully!

CBSE - XII Science - Biology - Molecular Basis of Inheritance

What are the functions of mRNA and tRNA? What anticodons will be required to recognise the following codons: (i) AAU, (ii) CGA, (iii) UAU and (iv) GCA?  

Asked by Topperlearning User 16th June 2014, 5:12 PM
Answered by Expert

Answer this question

Your answer has been posted successfully!

CBSE - XII Science - Biology - Molecular Basis of Inheritance

Explain the dual function of AUG codon. Give the sequence of bases it is transcribed from and its anticodon. 

Asked by Topperlearning User 16th June 2014, 5:12 PM
Answered by Expert

Answer this question

Your answer has been posted successfully!

CBSE - XII Science - Biology - Molecular Basis of Inheritance

What is a transcription unit?

Asked by Topperlearning User 16th June 2014, 5:12 PM
Answered by Expert

Answer this question

Your answer has been posted successfully!

CBSE - XII Science - Biology - Molecular Basis of Inheritance

Mention two additional processing which hnRNA needs to undergo after splicing so as to become functional. 

Asked by Topperlearning User 16th June 2014, 5:12 PM
Answered by Expert

Answer this question

Your answer has been posted successfully!

CBSE - XII Science - Biology - Molecular Basis of Inheritance

What is an anticodon? 

Asked by Topperlearning User 16th June 2014, 5:12 PM
Answered by Expert

Answer this question

Your answer has been posted successfully!

CBSE - XII Science - Biology - Molecular Basis of Inheritance

If the sequence of the coding strand in a transcription unit is written as follows: 5'·ATGCATGCATGCATGCATGCATGCATGC·3'. Write down the sequence of mRNA. 

Asked by Topperlearning User 16th June 2014, 5:12 PM
Answered by Expert

Answer this question

Your answer has been posted successfully!

CBSE - XII Science - Biology - Molecular Basis of Inheritance

The sequence of one strand of DNA is written as follows: 5'- ATGCATGCATGCATGCATGCATGCATGC - 3'. Write down the sequence of the complementary strand in 5' ~ 3' direction.

Asked by Topperlearning User 16th June 2014, 5:12 PM
Answered by Expert

Answer this question

Your answer has been posted successfully!